Please wait a minute...
European Journal of Gynaecological Oncology  2020, Vol. 41 Issue (3): 432-438    DOI: 10.31083/j.ejgo.2020.03.5241
Original Research Previous articles | Next articles
Oleic acid promotes the development of endometrial cancer by up-regulating KLF4 expression
J. Feng1, J. Wu1, M. Zhang1, J. Wang1, K. Chen1, X. Li1, J. Xie1, J. Zhang1, C. Wang1()
1Shihezi University School of Medicine, Shihezi, Xinjiang 832000, China
Download:  PDF(3165KB)  ( 329 ) Full text   ( 7 )
Export:  BibTeX | EndNote (RIS)      
Abstract  

Objective: To investigate the role and possible molecular mechanism of the transcription factor Krüppel-like factor 4 (KLF4) in the biological phenotype of endometrial cancer cells following induction by oleic acid (OA). Materials and Methods: Ishikawa endometrial cancer cells were grown in vitro with different concentrations of oleic acid. Cell proliferation was measured using the Counting Kit-8 (CCK-8) assay. Cell migration and invasion were evaluated by transwell chamber assay and scratch assay, respectively. The mRNA and protein expression levels of KLF4, ERα, Bcl2, MMP1, MMP9, were evaluated by qRT-PCR and Western blot, respectively. Results: The expression levels of KLF4, ERα, Bcl2, MMP1 and MMP9 increased significantly (p < 0.05) upon stimulation of the endometrial cancer cells with oleic acid (200 μM), together with the migration and invasion abilities of the cells (p < 0.05). Up-regulation of KLF4 caused the expression of ERα, Bcl2 and MMP9 to increase significantly (p < 0.05), whereas down-regulation of KLF4 caused the expression of ERα, Bcl2, MMP1 and MMP9 to significantly decrease (p < 0.05). The increased expression levels of ERα, Bcl2, MMP1 and MMP9 upon 200 μM oleic acid stimulation were significantly blocked (p < 0.05) by down-regulation of KLF4. Conclusion: oleic acid promotes the expression of ERα, Bcl2, MMP1 and MMP9 via up-regulation of KLF4, thus resulting in increased migration and invasion abilities of endometrial cancer cells.

Key words:  OA      KLF4      Endometrial cancer      Migration      Invasion     
Submitted:  11 April 2019      Accepted:  15 July 2019      Published:  15 June 2020     
Fund: Projects of Shihezi University(GJHZ201703)
*Corresponding Author(s):  C. Wang     E-mail:  wangcuizhe905@163.com

Cite this article: 

J. Feng, J. Wu, M. Zhang, J. Wang, K. Chen, X. Li, J. Xie, J. Zhang, C. Wang. Oleic acid promotes the development of endometrial cancer by up-regulating KLF4 expression. European Journal of Gynaecological Oncology, 2020, 41(3): 432-438.

URL: 

https://ejgo.imrpress.com/EN/10.31083/j.ejgo.2020.03.5241     OR     https://ejgo.imrpress.com/EN/Y2020/V41/I3/432

Figure 1.  — The growth rate of Ishikawa cells was evaluated under different concentrations of OA. *50 μM, 1000 μM stimulation group vs. blank control group, #1500 μM vs. blank control group, *,#p < 0.05, **,##p < 0.01.

Figure 2.  — OA stimulation of Ishikawa cells and its effects on cell migration, invasion and proliferation ability. A) 50 μM and 200 μM OA-stimulated Ishikawa cells for 0, 24, 48, 72, and 96 h. CCK-8 assay was used to assess cell proliferation. B, C) 50 μM and 200 μM OA- stimulated Ishikawa cells incubated for 0, 24, and 48 h. The area of scratch healing was assessed with a × 100 microscope. D, E) Transwell migration experiment with 50 μM and 200 μM OA-stimulated Ishikawa cells grown for 24 h, × 200 microscope; F, G) Transwell invasion test with 50 μM and 200 μM OA-stimulated Ishikawa cells grown for 48 h, × 200 microscope; *NC vs. 50 μM; #NC vs. 200 μM; *, #p < 0.05, **, ##p < 0.01.

Figure 3.  — Expression levels of ERα, Bcl2, MMP1 and MMP9 in Ishikawa cells following stimulation with 50 μM and 200 μM OA for 24 h. A, B, G, H and I show mRNA expression. C, D, E and F show protein expression. *NC vs. 200 μM; *p < 0.05.

Figure 4.  — Expression levels of ERα, Bcl2, MMP1 and MMP9 following up-regulation of KLF4. A, B, G, H and I show mRNA expression. C, D, E and F show protein expression. *experimental group vs. control group; *p < 0.05.

Figure 5.  — Expression levels of ERα and oncogene following down-regulation of KLF4. A, B, G, H and I show mRNA expression. C, D, E and F show protein expression. *experimental group vs. control group, *p < 0.05, **p < 0.01.

Figure 6.  — ERα and oncogene expression following simultaneous OA stimulation and down-regulation of KLF4. A, B, G, H, and I show mRNA expression. D, E, and F show protein expression. *OA + NC vs. OA + KLF4; *p < 0.05, **p < 0.01.

Table 1  - Primer sequences
Primer name Sequence (5′→3′) Size (bp)
Human-KLF4-F GGCACTACCGTAAACACACGC 140
Human-KLF4-R CTGGCAGTGTGGGTCATATC
Human-ERα-F TGTGCAATGACTATGCTTCA 149
Human-ERα-R GCTCTTCCTCCTGTTTTTA
Human- Bcl2-F TTCTTTGAGTTCGGTGGGGTC 304
Human- Bcl2-R TGCATATTTGTTTGGGGCAGG
Human-MMP1-F AATGTGCTACACGGATACCC 214
Human- MMP1-R CTTTGTGGCCAATTCCAGGA
Human- MMP9-F CGGAGTGGCAGGGGGAAGATGCTG 256
Human- MMP9-R GCAGGATGTCATAGGTCACGTAGC
Human-GAPDH-F GGTGGTCTCCTCTGACTTCAA 211
Human-GAPDH-R TCTTCCTCTTGTGCTCTTGCT
[1] Parkin D.M., Bray F., Ferlay J., Pisani P.: “Global cancer statistics, 2002” CA Cancer J. Clin., 2005, 55, 74.
doi: 10.3322/canjclin.55.2.74 pmid: 15761078
[2] Torre L.A., Bray F., Siegel R.L., Ferlay J., Lortet Tieulent J., Jemal A.: “Global cancer statistics, 2012”r. CA Cancer J. Clin., 2015, 65, 87.
doi: 10.3322/caac.21262 pmid: 25651787
[3] Greenwald Z.R., Huang L.N., Wissing M.D., Franco E.L., Gotlieb W.H.: “Does hormonal therapy for fertility preservation affect the survival of young women with early-stage endometrial cancer?” Cancer, 2017, 123, 1545.
pmid: 28026855
[4] Chathyan P., Clifford J.B., Helen R.G.: “Aging, adipose tissue, fatty acids and inflammation”. Biogerontology, 2015, 16, 235.
[5] Nomura D.K., Long J.Z., Niessen S., Hoover H.S., Ng S.W., Cravatt .: “Monoacylglycerol lipase regulates a fatty acid network that promotes cancer pathogenesis”. Cell, 2010, 140, 49.
[6] Przybytkowski E., Joly E., Nolan C.J., Hardy S., Francoeur A.M., Langelier Y., Prentki M.: “Upregulation of cellular triacylglycerol-free fatty acid cycling by oleate is associated with long-term serum-free survival of human breast cancer cells”. Biochem. Cell. Biol., 2007, 85, 301.
doi: 10.1139/o07-001 pmid: 17612624
[7] Liotti A., Cosimato V., Mirra P., Calì G., Conza D., Secondo A., et al.: “Oleic acid promotes prostate cancer malignant phenotype via the G protein-coupled receptor FFA1/GPR40”. J. Cell. Physiol., 2018, 233, 7367.
pmid: 29663374
[8] Yang P., Su C., Luo X., Zeng H., Zhao L., Wei L., et al.: “Dietary oleic acid-induced CD36 promotes cervical cancer cell growth and metastasis via up-regulation Src/ERK pathway”. Cancer Lett., 2018, 438, 76.
doi: 10.1016/j.canlet.2018.09.006
[9] Mcconnell B.B., Yang V.W.: “Mammalian Krüppel-like factors in health and diseases”. Physiol. Rev., 2010, 90, 1337.
pmid: 20959618
[10] Birsoy K., Chen Z., Friedman J.: “Transcriptional regulation of adipogenesis by KLF4”. Cell Metab., 2008, 7, 339.
doi: 10.1016/j.cmet.2008.02.001 pmid: 18396140
[11] Xu Q., Liu M., Zhang J., Xue L., Zhang G., Hu C., et al.: “Overex-pression of KLF4 promotes cell senescence through microRNA-203-survivin-p21 pathway”. Oncotarget, 2016, 7, 60290.
doi: 10.18632/oncotarget.11200 pmid: 27531889
[12] Wang B., Zhao M.Z., Cui N.P., Lin D.D., Zhang A.Y., Qin Y., et al.: “Krüppel-like factor 4 induces apoptosis and inhibits tumorigenic progression in SK-BR-3 breast cancer cells”. FEBS Open Bio., 2015, 5, 147.
[13] Engin A.: “Fat Cell and Fatty Acid Turnover in Obesity”. Adv. Exp. Med. Biol., 2017, 960, 135.
doi: 10.1007/978-3-319-48382-5_6 pmid: 28585198
[14] Lv W., Yang T.: “Identification of possible biomarkers for breast cancer from free fatty acid profiles determined by GC-MS and multivariate statistical analysis”. Clin. Biochem., 2012, 45, 127.
pmid: 22061338
[15] Haggerty A.F., Sarwer D.B., Schmitz K.H., Ko E.M., Allison K.C., Chu C.S.: “Obesity and Endometrial Cancer: A Lack of Knowledge but Opportunity for Intervention”. Nutr. Cancer, 2017, 69, 990.
doi: 10.1080/01635581.2017.1359313 pmid: 28937804
[16] Zhao H., Pflug B.R., Lai X., Wang M.: “Metabolic and molecular regulation of dietary polyunsaturated fatty acids on prostate cancer”. Proteomics Clin. Appl., 2016, 10, 267.
doi: 10.1002/prca.201500066 pmid: 26929070
[17] Fazio C., Piazzi G., Vitaglione P., Fogliano V., Munarini A., Prossomariti A., et al.: “Inflammation increases NOTCH1 activity via MMP9 and is counteracted by Eicosapentaenoic Acid-free fatty acid in colon cancer cells”. Sci. Rep., 2016, 6, 20670.
pmid: 26864323
[18] Xia S.H., Wang J., Kang J.X.: “Decreased n-6 /n-3 fatty acid ratio reduces the invasive potential of human lung cancer cells by down regulation of cell adhesion /invasion-related genes”. Carcinogenesis, 2005, 26, 779.
doi: 10.1093/carcin/bgi019 pmid: 15661810
[19] Blanckaert V., Ulmann L., Mimouni V., Antol J., Brancquart L., Chénais B.: “Docosahexaenoic acid intake decreases proliferation,increases apoptosis and decreases the invasive potential of the human breast carcinoma cell line MDA-MB-231”. Int. J. Oncol., 2010, 36 737.
doi: 10.3892/ijo_00000549 pmid: 20126994
[20] Kotronen A., Seppänen Laakso T., Westerbacka J., Kiviluoto T., Arola J., Ruskeepää A.L., et al.: “Comparison of lipid and fatty acid composition of the liver, subcutaneous and intra-abdominal adipose tissue, and serum”. Obesity (Silver Spring), 2010, 18, 937.
[21] Ben Fradj M.K., Ouanes Y., Hadj Taieb S., Sallemi A., Kallel A., Jemaa R., et al.: “Decreased Oleic Acid and Marine n-3 Polyunsaturated Fatty Acids in Tunisian Patients with Urothelial Bladder Cancer”. Nutr Cancer, 2018, 70, 1043.
doi: 10.1080/01635581.2018.1497668 pmid: 30183426
[22] Li S., Zhou Q., He H., Zhao Y., Liu Z.: “Peroxisome proliferator-activated receptor γ agonists induce cell cycle arrest through transcriptional regulation of Kruppel-like factor 4 (KLF4)”. J. Biol. Chem., 2013, 288, 4076.
doi: 10.1074/jbc.M111.317487 pmid: 23275339
[23] Zhang N., Zhang J., Shuai L., Zha L., He M., Huang Z., Wang Z.: “Kruppel-like factor 4 negatively regulates beta-catenin expression and inhibits the proliferation, invasion and metastasis of gastric cancer”. Int. J. Oncol., 2012, 40, 2038.
doi: 10.3892/ijo.2012.1395 pmid: 22407433
[24] Li Q., Gao Y., Jia Z., Mishra L., Guo K., Li Z., et al.: “Dysregulated Krüppel-like factor 4 and vitamin D receptor signaling contribute to progression of hepatocellular carcinoma”. Gastroenterology, 2012, 143, 799.
doi: 10.1053/j.gastro.2012.05.043
[25] Ohnishi S., Ohnami S., Laub F., Aoki K., Suzuki K., Kanai Y., et al.: “Downregulation and growth inhibitory effect of epithelialtype Kruppellike transcription factor KLF4, but not KLF5, in bladder cancer”. Biochem. Biophys. Res. Commun., 2003, 308, 251.
pmid: 12901861
[26] Hu W., Hofstetter W.L.: “Putative tumor-suppressive function of kruppel-like factor 4 in primary lung carcinoma”. Clin. Cancer Res., 2009, 15, 5688.
[27] Le Magnen C., Bubendorf L., Ruiz C., Zlobec I., Bachmann A., Heberer M., et al.: “Klf4 transcription factor is expressed in the cytoplasm of prostate cancer cells”. Eur. J. Cancer, 2013, 49, 955.
doi: 10.1016/j.ejca.2012.09.023 pmid: 23089465
[28] Nagata T., Shimada Y., Sekine S., Hori R., Matsui K., Okumura T., et al.: “Prognostic significance of NANOG and KLF4 for breast cancer”. Breast Cancer, 2014, 21, 96.
[29] Sunaga H., Matsui H., Anjo S., Syamsunarno M.R., Koitabashi N., Iso T., et al.: “Elongation of Long-Chain Fatty Acid Family Member 6 (Elovl6)-Driven Fatty Acid Metabolism Regulates Vascular Smooth Muscle Cell Phenotype Through AMP-Activated Protein Kinase/Krüppel-Like Factor 4 (AMPK/KLF4) Signaling”. J. Am. Heart Assoc., 2016, 5, 4014.
[30] Hara T., Kashihara D., Ichimura A., Kimura I., Tsujimoto G., Hirasawa A: “Role of free fatty acid receptors in the regulation of energy metabolism”. Biochim. Biophys. Acta, 2014, 1841, 1292.
pmid: 24923869
[31] Hirasawa A., Hara T., Katsuma S., Adachi T., Tsujimoto G.: “Free fatty acid receptors and drug discovery”. Biol. Pharm. Bull., 2008, 31, 1847.
doi: 10.1248/bpb.31.1847 pmid: 18827341
[32] Hardy S., St Onge G.G., Joly E., Langelier Y., Prentki M.: “Oleate promotes the proliferation of breast cancer cells via the G protein-coupled receptor GPR40”. J. Biol. Chem., 2005, 280, 13285.
doi: 10.1074/jbc.M410922200 pmid: 15695516
[33] Liu Z., Hopkins M.M., Zhang Z., Quisenberry C.B., Fix L.C., Galvan B.M., Meier K.E.: “Omega-3 fatty acids and other FFA4 agonists inhibit growth factor signaling in human prostate cancer cells”. J. Pharmacol. Exp. Ther., 2015, 352, 380.
pmid: 25491146
[34] Nehra D., Pan A.H., Le H.D., Fallon E.M., Carlson S.J., Kalish B.T., Puder M.: “Docosahexaenoic acid, G protein-coupled receptors, and melanoma: is G protein-coupled receptor 40 a potential therapeutic target?”. J. Surg. Res., 2014, 188, 451.
pmid: 24576779
[35] Ishii S., Hirane M., Kato S., Fukushima N., Tsujiuchi T.: “Opposite effects of GPR120 and GPR40 on cell motile activity induced by ethionine in liver epithelial cells”. Biochem. Biophys. Res. Commun., 2015, 456, 135.
doi: 10.1016/j.bbrc.2014.11.047 pmid: 25446111
[36] Wu Q., Wang H., Zhao X., Shi Y., Jin M., Wan B., et al.: “Identification of G-protein-coupled receptor 120 as a tumor-promoting receptor that induces angiogenesis and migration in human colorectal carcinoma”. Oncogene, 2013, 32, 5541.
doi: 10.1038/onc.2013.264
[1] Ikuji Shimazaki, Yasunori Hashiguchi, Makoto Yamauchi, Mari Kasai, Takeshi Fukuda, Tomoyuki Ichimura, Tomoyo Yasui, Toshiyuki Sumi. Secondary small cell vaginal cancer after operative therapy for endometrial cancer[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 821-823.
[2] Jaudah Al-Maghrabi, Haneen Al-Maghrabi. SIRT1 is overexpressed in endometrial adenocarcinoma: a tissue microarray analysis[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 699-704.
[3] Yu Hui Lim, Sheow Lei Lim, Linda Xiao Hui Lin, Lay Tin Soh, Hoon Seng Khoo Tan, Richard Ming Chert Yeo, Timothy Yong Kuei Lim. Sequential Chemoradiation versus Radiation for the Adjuvant Treatment of Stage III Endometrioid Adenocarcinoma of the Uterus[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 705-712.
[4] Eda Kucuktulu, Ahmet Fatih Yurekli. Simultaneous Integrated Intensity Modulated Radiotherapy Boost for Gynecological Cancer when Brachytherapy is not an Option[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 720-725.
[5] Jing Ma, Jiao Mu , Bin Lv , JiaYan Wu, Qing Gao, WeiSheng Huang, HongMei Dong. Sudden intrauterine fetal death due to a giant placental chorioangioma: a rare case report[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 838-840.
[6] Dongdong Zhang, Bingdong Zhu, Yajie Fu, Yin Han, Yufeng Wang, Xiaoyun Chen, Lang Zhang, Xiangwen Liu, Ying Zhang, Yuzhen Guo, Huiling Liu. Downregulation of α-enolase (ENO1) Inhibits Growth, Invasion, and Metastasis of Human Cervical Cancer Cells[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 762-768.
[7] Michelle F. Benoit, Kristy K. Ward. Uterine Cancer Normogram to Predict Lymph Node Metastasis: Comparison to the Mayo Algorithm and an External Validation of a Model in a North American Population[J]. European Journal of Gynaecological Oncology, 2020, 41(5): 681-684.
[8] Yusuf Cakmak, Tufan Oge. The effect of age on prediction of concurrent endometrial cancer in patients with atypical endometrial hyperplasia[J]. European Journal of Gynaecological Oncology, 2020, 41(4): 531-535.
[9] Di Wu, Jirui Zhang, Chengxi Yang. Effect of letrozole combined with testosterone on the proliferation and apoptosis of endometrial carcinoma cells[J]. European Journal of Gynaecological Oncology, 2020, 41(4): 604-608.
[10] Gen-Hai Zhu, Kang Wang, Lan Hong, Xin-Hui Fu, Fu-Jin Liu, Hai-Yan Huang. Safety and efficacy of fertility-sparing surgery for an orthotopic xenograft model of epithelial ovarian cancer in nude mice[J]. European Journal of Gynaecological Oncology, 2020, 41(4): 609-616.
[11] B.-H. Zhang, L. Li, J. Ji, J. Guo, X.-L. Zhou, H. Xu, F. Cao, X.-H. Tong. Prognostic value of Foxp3+ regulatory T cells in endometrial cancer: a meta-analysis[J]. European Journal of Gynaecological Oncology, 2020, 41(3): 339-342.
[12] U. Indraccolo, R. Martinello, G. Scutiero, G. Bernardi, C. Borghi, O. Brasile, P. Greco. Ten-year survival in patients with endometrial adenoacanthoma and endometrial adenocarcinoma with malignant squamous cell differentiation[J]. European Journal of Gynaecological Oncology, 2020, 41(3): 361-363.
[13] H. Ishibashi, M. Miyamoto, T. Aoyama, H. Soyama, H. Matsuura, H. Iwahashi, M. Takano, K. Furuya. The effect of six scheduled cycles of neoadjuvant chemotherapy on prognosis in advanced ovarian cancer[J]. European Journal of Gynaecological Oncology, 2020, 41(3): 386-390.
[14] J.Y. Chen, Z.Q. Wang, S.C. Liang, H.Y. Hou, D.B. Chen, J.L. Wang. Sentinel lymph node mapping with carbon nanoparticles in endometrial cancer[J]. European Journal of Gynaecological Oncology, 2020, 41(3): 408-414.
[15] S. Liu, F. Ruan, M. Shi, Y. Liu, W. Li, B. Bi, H. Wang, W. Lv. Safe fertility-preserving management in a young woman with endometrial cancer[J]. European Journal of Gynaecological Oncology, 2020, 41(3): 476-479.
No Suggested Reading articles found!